WormBase Gene ID
|
WBGene00055212 | Gene Name | Cre-unc-32 |
| Sequence Name
|
CRE12197 | Organism | Caenorhabditis remanei |
| Automated Description | Predicted to enable proton-transporting ATPase activity, rotational mechanism. Predicted to be involved in proton transmembrane transport. Predicted to be part of vacuolar proton-transporting V-type ATPase, V0 domain. Is an ortholog of C. elegans unc-32. In C. elegans, unc-32 is involved in several processes, including cholinergic synaptic transmission; positive regulation of neurotransmitter secretion; and response to stress. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CRE12197.1 | CRE12197.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cre-unc-32, GTGGAATTCCAATCCAAATTCTACGGAGGTCTCGGATACCAATTCAGTCCATTCTCGTTC, WBGene00055212 | Expr1100606 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
