WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00054802 Gene Name  Cre-spe-44
Sequence Name  ? CRE25435 Organism  Caenorhabditis remanei
Automated Description  Predicted to enable DNA binding activity. Expressed in germ line and in male. Is an ortholog of C. elegans spe-44. In C. elegans, spe-44 is involved in positive regulation of transcription by RNA polymerase II and spermatogenesis. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE25435.1 CRE25435.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE25435 CRE25435   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr11707   Isolated gonads from C. remanei males were immunostained with the anti- SPE-44 antibody (which recognizes a carboxy-terminal epitope whose sequence is conserved among the spe-44 orthologs). As in C. elegans, we observed SPE-44 labeling of the chromatin of pachytene nuclei, with the notable exception of the presumed X chromosome.
Cre-tag-347, CGCTCTTGGAATTCAACCAGTCATTGTTCAACGTGTGCAGTCGATCGAAAGAAATGTGTA, WBGene00054802   Expr1100630 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region