WormBase Gene ID
|
WBGene00052373 | Gene Name | Cre-hmp-1 |
| Sequence Name
|
CRE27016 | Organism | Caenorhabditis remanei |
| Automated Description | Predicted to enable actin filament binding activity and cadherin binding activity. Predicted to be involved in cell adhesion. Is an ortholog of C. elegans hmp-1. In C. elegans, hmp-1 is involved in several processes, including cell-cell adhesion mediated by cadherin; cortical actin cytoskeleton organization; and embryonic morphogenesis. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CRE27016.1 | CRE27016.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cre-hmp-1, CGGACGTAAATTGAATATCGAGTGGCGAATGGCTCCACCTAAAAAGCAACCACTTGTACG, WBGene00052373 | Expr1109763 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
