WormBase Gene ID
|
WBGene00051849 | Gene Name | Cre-cst-1 |
| Sequence Name
|
CRE00825 | Organism | Caenorhabditis remanei |
| Automated Description | Predicted to enable ATP binding activity and protein serine/threonine kinase activity. Predicted to be involved in protein phosphorylation. Is an ortholog of C. elegans cst-1. In C. elegans, cst-1 is involved in determination of adult lifespan and muscle cell development. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CRE00825.1 | CRE00825.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cre-cst-1, TTCATCCGATGCGTGCAATTTTCATGATCCCTACAAAGCCTCCGCCGACATTCAAAAAAC, WBGene00051849 | Expr1096203 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
