Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG24462.1 | CBG24462.1 | [unknown] |
Other
9 Allele
| Public Name |
|---|
| WBVar00134289 |
| WBVar00134290 |
| WBVar00134291 |
| WBVar00134292 |
| WBVar00134293 |
| WBVar00134287 |
| WBVar00134288 |
| WBVar00053229 |
| WBVar00053234 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_upregulated | |
| Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG24462, CAAAACCAGACACTCCCCATCGAGGCATTAATTTCTCAACAGCATGCCATTGAAGCCACG, WBGene00042566 | Expr1059511 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
