Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG23978.1 | CBG23978.1 | [unknown] |
Other
16 Allele
| Public Name |
|---|
| WBVar00033754 |
| WBVar00006074 |
| WBVar00036797 |
| WBVar00033759 |
| WBVar00006079 |
| WBVar00133602 |
| WBVar00033764 |
| WBVar00006084 |
| WBVar00033769 |
| WBVar00006089 |
| WBVar00036782 |
| WBVar00033774 |
| WBVar00006094 |
| WBVar00036787 |
| WBVar00033779 |
| WBVar00036792 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Heat shock: 34C 30min. | Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min. | DESeq2 v 1.18.1, fold change > 2, FDR < 0.01. | WBPaper00058955:heatshock_upregulated_CBG |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG23978, AAGTCGTTTGCTTGCTGGGCTGCGTGGCAATGGGAATTCTAGGGATAATAACGAATAACT, WBGene00042197 | Expr1066468 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
