WormBase Gene ID
|
WBGene00041795 | Gene Name | Cbr-srpa-68 |
| Sequence Name
|
CBG23435 | Organism | Caenorhabditis briggsae |
| Automated Description | Predicted to enable 7S RNA binding activity; endoplasmic reticulum signal peptide binding activity; and signal recognition particle binding activity. Predicted to be involved in SRP-dependent cotranslational protein targeting to membrane. Predicted to be part of signal recognition particle, endoplasmic reticulum targeting. Is an ortholog of C. elegans srpa-68. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG23435.1 | CBG23435.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG23435, GCAAGCCTTCCACCAGCTTTCATTCCAATGCCTAATAAGCCAATTTTCTTCGATTTGGCC, WBGene00041795 | Expr1054604 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
