Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG23036.1 | CBG23036.1 | [unknown] |
Other
16 Allele
| Public Name |
|---|
| WBVar00132680 |
| WBVar00132681 |
| WBVar00132684 |
| WBVar00132685 |
| WBVar00132682 |
| WBVar00132683 |
| WBVar00132688 |
| WBVar00132689 |
| WBVar00132686 |
| WBVar00132687 |
| WBVar00132692 |
| WBVar00132693 |
| WBVar00132690 |
| WBVar00132691 |
| WBVar00132694 |
| WBVar00132695 |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-klp-6, TTCATCAACGGAAAACCGGTGCACGGCGAGACGCAACTCCAACAAAACGATCGTGTATTT, WBGene00041465 | Expr1062376 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
