Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG22774.1 | CBG22774.1 | [unknown] |
Other
19 Allele
| Public Name |
|---|
| WBVar00035834 |
| WBVar00007804 |
| WBVar00007774 |
| WBVar00035839 |
| WBVar00007809 |
| WBVar00007779 |
| WBVar00035844 |
| WBVar00007784 |
| WBVar00035849 |
| WBVar00007789 |
| WBVar00007759 |
| WBVar00132408 |
| WBVar00007794 |
| WBVar00132409 |
| WBVar00007764 |
| WBVar00132407 |
| WBVar00007799 |
| WBVar00132410 |
| WBVar00007769 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG22774, AAACTTAAACAATCAGGCGTTCGCACAATTTGGCAGCATTTCCCCCGTGCATTCCATGGT, WBGene00041259 | Expr1060819 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
