Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG22513.1 | CBG22513.1 | [unknown] |
Other
85 Allele
| Public Name |
|---|
| WBVar00139938 |
| WBVar00139939 |
| WBVar00139941 |
| WBVar00139942 |
| WBVar00139940 |
| WBVar00139945 |
| WBVar00139946 |
| WBVar00139943 |
| WBVar00139944 |
| WBVar00139947 |
| WBVar00131840 |
| WBVar00131841 |
| WBVar00131838 |
| WBVar00131839 |
| WBVar00131844 |
| WBVar00131845 |
| WBVar00131842 |
| WBVar00131843 |
| WBVar00131848 |
| WBVar00131849 |
| WBVar00034052 |
| WBVar00131846 |
| WBVar00131847 |
| WBVar00131852 |
| WBVar00131853 |
| WBVar00131850 |
| WBVar00034057 |
| WBVar00131851 |
| WBVar00131856 |
| WBVar00131857 |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_upregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-cdh-10, GAGAATCAGAAGATGTTCAATTTGACGTTGGTTTCTGGAGATGAGGGATACAGAAGTGAG, WBGene00041052 | Expr1055648 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
| CBG22514, TCGCGCTAATTGGACTACTAATCTTTGTTTGCTGTGTCTCTAAGTATCAGAGATACTTAA, WBGene00041053 | Expr1069961 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
