Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG22078.1 | CBG22078.1 | [unknown] |
Other
37 Allele
| Public Name |
|---|
| WBVar00131007 |
| WBVar00131006 |
| WBVar00131009 |
| WBVar00131008 |
| WBVar00131011 |
| WBVar00131010 |
| WBVar00131012 |
| WBVar00018829 |
| WBVar00130977 |
| WBVar00130979 |
| WBVar00130978 |
| WBVar00130981 |
| WBVar00130980 |
| WBVar00130983 |
| WBVar00130982 |
| WBVar00130985 |
| WBVar00130984 |
| WBVar00130987 |
| WBVar00130986 |
| WBVar00130989 |
| WBVar00130988 |
| WBVar00130991 |
| WBVar00130990 |
| WBVar00130993 |
| WBVar00130992 |
| WBVar00130995 |
| WBVar00130994 |
| WBVar00130997 |
| WBVar00130996 |
| WBVar00130999 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-gsa-1, GAGCAAGATATCCTTAGATGTCGTGTCATGACCACCGGAATTTTCGAGACCAAATTCGAA, WBGene00040711 | Expr1058626 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
6 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| involved_in |
