Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG21848.1 | CBG21848.1 | [unknown] |
Other
6 Allele
| Public Name |
|---|
| WBVar00130535 |
| WBVar00130534 |
| WBVar00130537 |
| WBVar00130536 |
| WBVar00130539 |
| WBVar00130538 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG21850, GGAACTACACGCCAAGTTTTTTGAACTTCGACCGGATATTGCTCAAGTTTTGCATTTGTA, WBGene00040531 | Expr1058253 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
| CBG21848, AATTCAATTGTTCTGGAATCGCCTCGGAAATTTCATCGCTTGCAAATCAGTGTCTGATGA, WBGene00040529 | Expr1057109 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
