WormBase Gene ID
|
WBGene00040309 | Gene Name | Cbr-tra-3 |
| Sequence Name
|
CBG21580 | Brief Description | Cbr-tra-3 encodes a calpain-like protease orthologous to C. elegans TRA-3; like in C. elegans, mutations in Cbr-tra-3 result in sexual cell fate transformations of XX hermaphrodites, resulting in one-armed gonads that only makes sperm, abnormal male tails with reduced sensory rays and spicules, and a protruding vulva phenotype. |
| Organism | Caenorhabditis briggsae | Automated Description | Predicted to enable calcium-dependent cysteine-type endopeptidase activity. Predicted to be involved in proteolysis. Is an ortholog of C. elegans tra-3. In C. elegans, tra-3 is involved in proteolysis and sex determination. |
| Biotype | SO:0001217 | Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG21580.1 | CBG21580.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-tra-3, ACAAATCGTGTTCTCCGAGTGGACTACAAATGGAAAAAAGAGTGGAGCACCGGATGATCG, WBGene00040309 | Expr1054951 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
