Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG21363.1 | CBG21363.1 | [unknown] |
Other
11 Allele
| Public Name |
|---|
| WBVar00129857 |
| WBVar00129859 |
| WBVar00129858 |
| WBVar00129861 |
| WBVar00129860 |
| WBVar00129863 |
| WBVar00129862 |
| WBVar00129865 |
| WBVar00129864 |
| WBVar00129867 |
| WBVar00129866 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG21363, TTCAAGAGATACTGTAGAGTGGATGGTGCGAAAAGTTGATCTTTCGGTTTTCATAGATCA, WBGene00040167 | Expr1056037 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
