Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG21212.1 | CBG21212.1 | [unknown] |
Other
13 Allele
| Public Name |
|---|
| WBVar00139545 |
| WBVar00139546 |
| WBVar00139544 |
| WBVar00139549 |
| WBVar00139547 |
| WBVar00139548 |
| WBVar00139550 |
| WBVar00129551 |
| WBVar00129550 |
| WBVar00129553 |
| WBVar00129552 |
| WBVar00129557 |
| WBVar00129556 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG21212, GCTTGATGAGGAGTGTATCGTTCCAAAAGCCACTGATATGACATATGTCGACAAACTGCT, WBGene00040055 | Expr1058441 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
