Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG21104.1 | CBG21104.1 | [unknown] |
Other
16 Allele
| Public Name |
|---|
| WBVar00129279 |
| WBVar00129294 |
| WBVar00129295 |
| WBVar00129290 |
| WBVar00129291 |
| WBVar00129293 |
| WBVar00129283 |
| WBVar00129284 |
| WBVar00129285 |
| WBVar00129286 |
| WBVar00129280 |
| WBVar00129281 |
| WBVar00129282 |
| WBVar00129287 |
| WBVar00129288 |
| WBVar00129289 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_downregulated |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG21104, AACCACCATGGAAAAGTTCCCCCTGGTCGTCGGAACCAAATTCAACATTCCATTCCTTTT, WBGene00039968 | Expr1056401 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
| CBG21102, GCGGATCTTCTTGCCACGTCATCAGTCATGTTGACGACCTACTCAAGTCTTGGACCACAT, WBGene00039966 | Expr1067593 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
