Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG20522b.1 | CBG20522b.1 | [unknown] | |
| Transcript:CBG20522a.1 | CBG20522a.1 | [unknown] |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:CBG20522a | CBG20522a | [unknown] | |
| CDS:CBG20522b | CBG20522b | [unknown] |
9 Allele
| Public Name |
|---|
| WBVar00009859 |
| WBVar00128715 |
| WBVar00128714 |
| WBVar00128713 |
| WBVar00128712 |
| WBVar00128717 |
| WBVar00128716 |
| WBVar00128711 |
| WBVar00128710 |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG20522, TTGGCGGAGAAGAAAATTCTGCAACGACTCAACCAGCTATTACGGCGAAAAGCCCAGGAG, WBGene00039489 | Expr1061801 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
