Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG20323.1 | CBG20323.1 | [unknown] |
Other
23 Allele
| Public Name |
|---|
| WBVar00043749 |
| WBVar00043744 |
| WBVar00043759 |
| WBVar00043754 |
| WBVar00043764 |
| WBVar00043709 |
| WBVar00043704 |
| WBVar00043714 |
| WBVar00043719 |
| WBVar00043724 |
| WBVar00043729 |
| WBVar00043734 |
| WBVar00043739 |
| WBVar00043679 |
| WBVar00043674 |
| WBVar00043684 |
| WBVar00043689 |
| WBVar00043694 |
| WBVar00043699 |
| WBVar00128530 |
| WBVar00128528 |
| WBVar00128527 |
| WBVar00128529 |
4 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 3 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day3_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-cyp-42A1, GCAAAATTGAGAACGGATCAAATGAGAGTGGCCGCCGAGCTGATAATTCGTCCACTGTTT, WBGene00039335 | Expr1050720 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
