Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG20236.1 | CBG20236.1 | [unknown] |
Other
10 Allele
| Public Name |
|---|
| WBVar00128362 |
| WBVar00128361 |
| WBVar00128360 |
| WBVar00128355 |
| WBVar00128359 |
| WBVar00128358 |
| WBVar00128357 |
| WBVar00128356 |
| WBVar00028747 |
| WBVar00028742 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG20236, AGTACTCGCAAGACCAATTATTCTTCTTAGCGTACACCCAAGGATGGTGTGCTTTAAGAT, WBGene00039271 | Expr1054038 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
