Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG19969.1 | CBG19969.1 | [unknown] |
Other
18 Allele
| Public Name |
|---|
| WBVar00039689 |
| WBVar00039699 |
| WBVar00039694 |
| WBVar00039679 |
| WBVar00039684 |
| WBVar00039709 |
| WBVar00039704 |
| WBVar00127975 |
| WBVar00127974 |
| WBVar00127973 |
| WBVar00028027 |
| WBVar00028032 |
| WBVar00028037 |
| WBVar00028042 |
| WBVar00028012 |
| WBVar00028047 |
| WBVar00028017 |
| WBVar00028022 |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG19969, CGATTTGTCTCTACCGGATTCCGAGCATTTATCTCATCGCTTATTGAAATTCAAGAACAA, WBGene00039085 | Expr1056495 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
