Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG19758.1 | CBG19758.1 | [unknown] |
Other
20 Allele
| Public Name |
|---|
| WBVar00001254 |
| WBVar00001249 |
| WBVar00001244 |
| WBVar00001264 |
| WBVar00001259 |
| WBVar00127772 |
| WBVar00127771 |
| WBVar00127770 |
| WBVar00127774 |
| WBVar00127773 |
| WBVar00127769 |
| WBVar00127768 |
| WBVar00127767 |
| WBVar00127766 |
| WBVar00127765 |
| WBVar00127764 |
| WBVar00028379 |
| WBVar00028364 |
| WBVar00028369 |
| WBVar00028374 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_upregulated | |
| Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG19758, GTGCTGAATACTGGAAAAATGACAAGTGAGGAGGCGAAGGGATTCGTGGAGATGTTGATT, WBGene00038925 | Expr1060553 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
9 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| located_in | |
| part_of |
