Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG19709.1 | CBG19709.1 | [unknown] |
Other
11 Allele
| Public Name |
|---|
| WBVar00028154 |
| WBVar00028149 |
| WBVar00127691 |
| WBVar00127694 |
| WBVar00127693 |
| WBVar00127692 |
| WBVar00028174 |
| WBVar00028159 |
| WBVar00028179 |
| WBVar00028164 |
| WBVar00028169 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG19709, ACTGAACACCGACCAATTATCAATAAGGAATACAGTTTGGAGCAGCTTGGACAGGCTCAT, WBGene00038883 | Expr1061365 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
