Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG19701.1 | CBG19701.1 | [unknown] |
Other
15 Allele
| Public Name |
|---|
| WBVar00027452 |
| WBVar00027422 |
| WBVar00027392 |
| WBVar00027457 |
| WBVar00027427 |
| WBVar00027397 |
| WBVar00027462 |
| WBVar00027432 |
| WBVar00027402 |
| WBVar00027437 |
| WBVar00027407 |
| WBVar00027442 |
| WBVar00027412 |
| WBVar00027447 |
| WBVar00027417 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-tag-271, CAAGACATCGAGGATGAGCAATTCCTGCGATTCTCCATGGGCTCGGCGGCAAATTCAAAT, WBGene00038875 | Expr1065204 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
