WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00038403 Gene Name  CBG19133
Sequence Name  ? CBG19133 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable glutathione hydrolase activity. Predicted to be involved in glutathione catabolic process. Is an ortholog of C. elegans H14N18.4. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

7 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG19133a.1 CBG19133a.1   [unknown]
Transcript:CBG19133b.1 CBG19133b.1   [unknown]
Transcript:CBG19133c.1 CBG19133c.1   [unknown]
Transcript:CBG19133f.1 CBG19133f.1   [unknown]
Transcript:CBG19133g.1 CBG19133g.1   [unknown]
Transcript:CBG19133d.1 CBG19133d.1   [unknown]
Transcript:CBG19133e.1 CBG19133e.1   [unknown]
 

Other

7 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG19133e CBG19133e   [unknown]
CDS:CBG19133f CBG19133f   [unknown]
CDS:CBG19133g CBG19133g   [unknown]
CDS:CBG19133a CBG19133a   [unknown]
CDS:CBG19133b CBG19133b   [unknown]
CDS:CBG19133c CBG19133c   [unknown]
CDS:CBG19133d CBG19133d   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_upregulated
  Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day6_vs_Day1_downregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG19133, ATACAAGCAGAATTTCACAGTGGTCCCACGACAGAAATCAGTTGTTCAGGGTCTCATTTC, WBGene00038403   Expr1067096 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  involved_in

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region