WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00038151 Gene Name  Cbr-eya-1
Sequence Name  ? CBG18807 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable protein tyrosine phosphatase activity. Is an ortholog of C. elegans eya-1. In C. elegans, eya-1 is involved in several processes, including egg-laying behavior; positive regulation of cellular response to heat; and regulation of apoptotic process. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG18807c.1 CBG18807c.1   [unknown]
Transcript:CBG18807b.1 CBG18807b.1   [unknown]
Transcript:CBG18807a.1 CBG18807a.1   [unknown]
Transcript:CBG18807a.2 CBG18807a.2   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG18807a CBG18807a   [unknown]
CDS:CBG18807c CBG18807c   [unknown]
CDS:CBG18807b CBG18807b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day3_vs_Day1_upregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-eya-1, TCAGACGAGATATGGGAAAAAGTGCAGTTTCATTTATGTGACGTCCAGAGATACATCGAG, WBGene00038151   Expr1061671 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region