Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG18554.1 | CBG18554.1 | [unknown] |
Other
13 Allele
| Public Name |
|---|
| WBVar00004842 |
| WBVar00004832 |
| WBVar00004837 |
| WBVar00004822 |
| WBVar00004827 |
| WBVar00004812 |
| WBVar00004817 |
| WBVar00126540 |
| WBVar00126543 |
| WBVar00126544 |
| WBVar00126541 |
| WBVar00126542 |
| WBVar00126545 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG05161, GGGAAATCGTGCCAACCGGATTGGAAACGTTTGAATCGATAAAAGTGGTTGCTGATGAGC, WBGene00027678 | Expr1064582 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
| CBG18554, GGAGATTACTGTAGATTGTGGGGTGTTCTTCAATTGTGCTATAGGGATCAAGTTTCAAAG, WBGene00037950 | Expr1057483 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
