Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG18398.1 | CBG18398.1 | [unknown] |
Other
17 Allele
| Public Name |
|---|
| WBVar00126320 |
| WBVar00126323 |
| WBVar00126324 |
| WBVar00126321 |
| WBVar00126322 |
| WBVar00126316 |
| WBVar00126317 |
| WBVar00126315 |
| WBVar00126318 |
| WBVar00126319 |
| WBVar00126330 |
| WBVar00126331 |
| WBVar00126327 |
| WBVar00126328 |
| WBVar00126325 |
| WBVar00126326 |
| WBVar00126329 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG18398, TATCGATCGCGCAATTCGTGTGCCCAAAAACGACACCATCATCCATACGGCATACTCAAT, WBGene00037833 | Expr1050659 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
