WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00037276 Gene Name  Cbr-csr-1
Sequence Name  ? CBG17720 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable RNA binding activity. Is an ortholog of C. elegans csr-1. In C. elegans, csr-1 is involved in P granule assembly; mitotic sister chromatid segregation; and siRNA-mediated gene silencing by mRNA destabilization. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG17720.1 CBG17720.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG17720 CBG17720   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr16077   We examined the subcellular localization of CBR-CSR-1 in embryos and found that it localizes to the nucleus, mitotic chromosomes and centrosomes from the first mitotic cell division onward. Interestingly, we also observed localization of CBR-CSR-1 to the cleavage furrow during embryonic cell divisions, a pattern that has not been described for C. elegans. However, we did not detect CBR-CSR-1 granules in the cytoplasm of embryonic germ cells.
    Expr16078 In adult hermaphrodites, CBR-CSR-1 was enriched in both germline and somatic nuclei. We observed CBR-CSR-1 in association with oocyte nuclei and enriched on chromosomes in oocytes. Again, we did not reliably observe CSR-1 localization to perinuclear and cytoplasmic granules, which would be indicative of P granules. CBR-CSR-1 was also enriched in somatic gut nuclei, further supporting a nuclear role for this Argonaute.  
Cbr-csr-1, AGCGACAAATTTTCATCCAAGCTTTCCGTCCAGTACAAGGTACTGCCAAAGTTCCTTCTT, WBGene00037276   Expr1056444 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  enables

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region