Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG17447.1 | CBG17447.1 | [unknown] |
Other
21 Allele
| Public Name |
|---|
| WBVar00138606 |
| WBVar00138608 |
| WBVar00138607 |
| WBVar00138609 |
| WBVar00138611 |
| WBVar00138610 |
| WBVar00138613 |
| WBVar00138612 |
| WBVar00138615 |
| WBVar00138614 |
| WBVar00138617 |
| WBVar00138616 |
| WBVar00138619 |
| WBVar00138618 |
| WBVar00041689 |
| WBVar00041684 |
| WBVar00041699 |
| WBVar00041694 |
| WBVar00041709 |
| WBVar00041704 |
| WBVar00125380 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-sulp-7, GCATTGTTATTGTCGCACTTCGAGGCATGTTTCTACATTTGACAAACTTTTGGACACTAT, WBGene00037061 | Expr1050127 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
