Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG17404a.1 | CBG17404a.1 | [unknown] | |
| Transcript:CBG17404b.1 | CBG17404b.1 | [unknown] |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:CBG17404b | CBG17404b | [unknown] | |
| CDS:CBG17404a | CBG17404a | [unknown] |
33 Allele
| Public Name |
|---|
| WBVar00041444 |
| WBVar00041404 |
| WBVar00041409 |
| WBVar00041414 |
| WBVar00041419 |
| WBVar00041424 |
| WBVar00041429 |
| WBVar00041439 |
| WBVar00041434 |
| WBVar00041369 |
| WBVar00041364 |
| WBVar00041374 |
| WBVar00041379 |
| WBVar00041384 |
| WBVar00041389 |
| WBVar00041394 |
| WBVar00041399 |
| WBVar00041359 |
| WBVar00041354 |
| WBVar00012929 |
| WBVar00012924 |
| WBVar00012919 |
| WBVar00012964 |
| WBVar00012959 |
| WBVar00012954 |
| WBVar00012949 |
| WBVar00012944 |
| WBVar00012939 |
| WBVar00012934 |
| WBVar00125315 |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG17404, GGATGTGAAGGAACACTGAATAACTTCCACTCGCTCCAAAGATGTACAGAGATTTGCTGC, WBGene00037041 | Expr1055524 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
