Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG17205.1 | CBG17205.1 | [unknown] |
Other
13 Allele
| Public Name |
|---|
| WBVar00124780 |
| WBVar00124781 |
| WBVar00124782 |
| WBVar00124776 |
| WBVar00124777 |
| WBVar00124774 |
| WBVar00124775 |
| WBVar00124778 |
| WBVar00124779 |
| WBVar00124772 |
| WBVar00124773 |
| WBVar00124770 |
| WBVar00124771 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG17205, CTATCAAAACACTGTTCTTTGATGCCTATAACTCACATAATACGTTGATGGACGCTGCTC, WBGene00036912 | Expr1050346 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
