Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG16916.1 | CBG16916.1 | [unknown] |
Other
8 Allele
| Public Name |
|---|
| WBVar00044609 |
| WBVar00015589 |
| WBVar00015584 |
| WBVar00124380 |
| WBVar00124381 |
| WBVar00124382 |
| WBVar00124378 |
| WBVar00124379 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG16916, CATCAAAGAGTCGGAACTCAACGACTTGATATCTGTGGTTTATGCATACAATTCGGAGGC, WBGene00036713 | Expr1052392 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
