WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00036679 Gene Name  Cbr-dct-1
Sequence Name  ? CBG16854 Organism  Caenorhabditis briggsae
Automated Description  Predicted to be involved in positive regulation of apoptotic process. Predicted to be located in membrane and mitochondrial envelope. Is an ortholog of C. elegans dct-1. In C. elegans, dct-1 is involved in several processes, including apoptotic process; determination of adult lifespan; and mitophagy. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG16854a.1 CBG16854a.1   [unknown]
Transcript:CBG16854b.1 CBG16854b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG16854b CBG16854b   [unknown]
CDS:CBG16854a CBG16854a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

3 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day6_vs_Day1_upregulated
Heat shock: 34C 30min. Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min. DESeq2 v 1.18.1, fold change > 2, FDR < 0.01. WBPaper00058955:heatshock_upregulated_CBG
  Transcripts that showed significantly increased expression in day 6 adults of C.briggsae AF16 comparing to in day 3 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day6_vs_Day3_upregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-dct-1, AAATGAGCCAATATATGCCTTATGAATCGGATTCTCTATTCAACGTTCGCGTAGTTTTCG, WBGene00036679   Expr1054353 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

3 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  involved_in

0 Homologues

0 Locations

3 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region