WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00036582 Gene Name  CBG16715
Sequence Name  ? CBG16715 Organism  Caenorhabditis briggsae
Automated Description  Predicted to be involved in carbohydrate metabolic process. Is an ortholog of C. elegans chts-1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

14 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG16715n.1 CBG16715n.1   [unknown]
Transcript:CBG16715m.1 CBG16715m.1   [unknown]
Transcript:CBG16715a.1 CBG16715a.1   [unknown]
Transcript:CBG16715b.1 CBG16715b.1   [unknown]
Transcript:CBG16715d.1 CBG16715d.1   [unknown]
Transcript:CBG16715c.1 CBG16715c.1   [unknown]
Transcript:CBG16715f.1 CBG16715f.1   [unknown]
Transcript:CBG16715e.1 CBG16715e.1   [unknown]
Transcript:CBG16715h.1 CBG16715h.1   [unknown]
Transcript:CBG16715g.1 CBG16715g.1   [unknown]
Transcript:CBG16715j.1 CBG16715j.1   [unknown]
Transcript:CBG16715i.1 CBG16715i.1   [unknown]
Transcript:CBG16715l.1 CBG16715l.1   [unknown]
Transcript:CBG16715k.1 CBG16715k.1   [unknown]
 

Other

14 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG16715n CBG16715n   [unknown]
CDS:CBG16715j CBG16715j   [unknown]
CDS:CBG16715k CBG16715k   [unknown]
CDS:CBG16715l CBG16715l   [unknown]
CDS:CBG16715m CBG16715m   [unknown]
CDS:CBG16715f CBG16715f   [unknown]
CDS:CBG16715g CBG16715g   [unknown]
CDS:CBG16715h CBG16715h   [unknown]
CDS:CBG16715i CBG16715i   [unknown]
CDS:CBG16715b CBG16715b   [unknown]
CDS:CBG16715c CBG16715c   [unknown]
CDS:CBG16715d CBG16715d   [unknown]
CDS:CBG16715e CBG16715e   [unknown]
CDS:CBG16715a CBG16715a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_upregulated
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day1_upregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG16715, TCACCGGAAGCCAGATGATTGACTGGATGAGAAGTCCATATGACCTGAACAACATCAAAA, WBGene00036582   Expr1058747 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  involved_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region