Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG16339b.1 | CBG16339b.1 | [unknown] | |
| Transcript:CBG16339a.1 | CBG16339a.1 | [unknown] |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:CBG16339b | CBG16339b | [unknown] | |
| CDS:CBG16339a | CBG16339a | [unknown] |
21 Allele
| Public Name |
|---|
| WBVar00055973 |
| WBVar00055968 |
| WBVar00055963 |
| WBVar00123811 |
| WBVar00123810 |
| WBVar00123812 |
| WBVar00123804 |
| WBVar00123803 |
| WBVar00123806 |
| WBVar00123805 |
| WBVar00123808 |
| WBVar00123807 |
| WBVar00123809 |
| WBVar00024734 |
| WBVar00024704 |
| WBVar00024739 |
| WBVar00024709 |
| WBVar00024714 |
| WBVar00024719 |
| WBVar00024724 |
| WBVar00024729 |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-tag-343, GTCTCCATCCAACTACCGTAATCCACGTGATTGTTTTCTTAACTTTTTGTGCTTTATTTT, WBGene00036304 | Expr1058582 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
