Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG16264.1 | CBG16264.1 | [unknown] |
Other
14 Allele
| Public Name |
|---|
| WBVar00055604 |
| WBVar00123712 |
| WBVar00123713 |
| WBVar00024154 |
| WBVar00024124 |
| WBVar00024159 |
| WBVar00024129 |
| WBVar00024164 |
| WBVar00024134 |
| WBVar00024169 |
| WBVar00024139 |
| WBVar00024144 |
| WBVar00024149 |
| WBVar00024119 |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_downregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG16264, ATGCAACTCTCTCCATGCCCAACTACAGCACCATATGTATGTATCTATTCTCCAGAAAAG, WBGene00036263 | Expr1059203 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
