Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG16240.1 | CBG16240.1 | [unknown] |
Other
9 Allele
| Public Name |
|---|
| WBVar00055559 |
| WBVar00123693 |
| WBVar00123692 |
| WBVar00123694 |
| WBVar00023964 |
| WBVar00023969 |
| WBVar00023954 |
| WBVar00023974 |
| WBVar00023959 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-dgn-2, ACGAACAAGCTCTTACCACTGACAATGGAGAACTACCAACGATGGAAAATACTACCGCCT, WBGene00036245 | Expr1062892 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
