Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG15998.1 | CBG15998.1 | [unknown] |
Other
18 Allele
| Public Name |
|---|
| WBVar00056994 |
| WBVar00123565 |
| WBVar00123564 |
| WBVar00123566 |
| WBVar00123561 |
| WBVar00123560 |
| WBVar00123563 |
| WBVar00123562 |
| WBVar00123554 |
| WBVar00123556 |
| WBVar00123555 |
| WBVar00123558 |
| WBVar00123557 |
| WBVar00123559 |
| WBVar00025664 |
| WBVar00025669 |
| WBVar00025674 |
| WBVar00025679 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG15998, GCAACTAATTCTCTTCTGCAAACGGTTCCACCTCAACCGTCAATGTTTTGGAATCCAGAT, WBGene00036081 | Expr1069404 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
