Genomics
3 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG15980c.1 | CBG15980c.1 | [unknown] | |
| Transcript:CBG15980a.1 | CBG15980a.1 | [unknown] | |
| Transcript:CBG15980b.1 | CBG15980b.1 | [unknown] |
Other
3 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:CBG15980c | CBG15980c | [unknown] | |
| CDS:CBG15980b | CBG15980b | [unknown] | |
| CDS:CBG15980a | CBG15980a | [unknown] |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 6 adults of C.briggsae AF16 comparing to in day 3 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day3_upregulated |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG15980, GTTCGTGAAGAGGTCGACGGGCTGCGTAGCAAAATTTTCGATCTGGAAAATCACGTTAGA, WBGene00036065 | Expr1063644 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
| CBG15981, CCAAAACCCGCGTCTCATCTTGTCTCTCCAAATCCGAAGCCAGTGTATACAGTTCCAAAA, WBGene00036066 | Expr1053965 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
