WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00035684 Gene Name  CBG15406
Sequence Name  ? CBG15406 Organism  Caenorhabditis briggsae
Automated Description  Predicted to be involved in stress response to metal ion. Is an ortholog of C. elegans F53A9.6 and F53A9.7. In C. elegans, F53A9.6 is involved in innate immune response. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG15406.1 CBG15406.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG15406 CBG15406   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

4 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day3_vs_Day1_upregulated
  Transcripts that showed significantly increased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day6_vs_Day1_upregulated
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day1_upregulated
Heat shock: 34C 30min. Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min. DESeq2 v 1.18.1, fold change > 2, FDR < 0.01. WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG15406, CATCATGGAGAACATCACTACGAGAGCCATCACGAGAGCCACCATCATGGACATCATCAT, WBGene00035684   Expr1065823 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  involved_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region