Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG15371.1 | CBG15371.1 | [unknown] |
Other
33 Allele
| Public Name |
|---|
| WBVar00018592 |
| WBVar00018597 |
| WBVar00018582 |
| WBVar00018587 |
| WBVar00018572 |
| WBVar00018577 |
| WBVar00122360 |
| WBVar00122362 |
| WBVar00122361 |
| WBVar00122364 |
| WBVar00122363 |
| WBVar00122355 |
| WBVar00122354 |
| WBVar00122357 |
| WBVar00122356 |
| WBVar00122359 |
| WBVar00122358 |
| WBVar00122351 |
| WBVar00122350 |
| WBVar00122353 |
| WBVar00122352 |
| WBVar00122348 |
| WBVar00122349 |
| WBVar00122371 |
| WBVar00122370 |
| WBVar00122373 |
| WBVar00122372 |
| WBVar00122374 |
| WBVar00122366 |
| WBVar00122365 |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG15371, TACTGTGAGAAGACCACATCATCTGATGACGCAAGGGATTTCGCAAAAATGTTGAGGAAC, WBGene00035665 | Expr1062468 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
| Cbr-dys-1, CGACATGCCAACGTATCTAATCGATGAAATGAACGATTCAGGAGGGGATACTACAGAATC, WBGene00035667 | Expr1050231 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
