WormBase Gene ID
|
WBGene00035571 | Gene Name | Cbr-gtf-2H5 |
| Sequence Name
|
CBG15257 | Organism | Caenorhabditis briggsae |
| Automated Description | Predicted to be involved in nucleotide-excision repair and transcription initiation at RNA polymerase II promoter. Predicted to be part of transcription factor TFIIH core complex. Is an ortholog of C. elegans gtf-2H5. In C. elegans, gtf-2H5 is involved in nucleotide-excision repair and transcription by RNA polymerase II. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG15257.1 | CBG15257.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG15257, ACGACACTCATCTCTTTATCGAAAAGGATATTGTACCAATGTTGGAGAGCAAGGTGGAGC, WBGene00035571 | Expr1056187 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
