Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG15139.1 | CBG15139.1 | [unknown] |
Other
15 Allele
| Public Name |
|---|
| WBVar00040154 |
| WBVar00040159 |
| WBVar00040164 |
| WBVar00040124 |
| WBVar00040129 |
| WBVar00040134 |
| WBVar00040139 |
| WBVar00040144 |
| WBVar00040149 |
| WBVar00011874 |
| WBVar00011869 |
| WBVar00011864 |
| WBVar00011859 |
| WBVar00011854 |
| WBVar00122209 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-trp-2, CCATTTTTTGTCCGAATGGACGGGGAAAACGATATTTGGAAGTTATTGTTGTTGTTCAAT, WBGene00035467 | Expr1063434 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
6 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| involved_in | |
| located_in | |
| enables | |
| enables | |
| involved_in |
