WormBase Gene ID
|
WBGene00035383 | Gene Name | Cbr-ced-10 |
| Sequence Name
|
CBG15031 | Organism | Caenorhabditis briggsae |
| Automated Description | Predicted to enable GTP binding activity and GTPase activity. Is an ortholog of C. elegans ced-10. In C. elegans, ced-10 is involved in several processes, including axon development; establishment or maintenance of cell polarity; and regulation of cellular component organization. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG15031.1 | CBG15031.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG15031, CCTCCAACCCGTCAGCCAGACTCAAGGATACGTGATGGCCAAAGAAATCAAGGCAGTCAA, WBGene00035383 | Expr1054528 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
