WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00035167 Gene Name  Cbr-ctbp-1
Sequence Name  ? CBG14767 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable NAD binding activity and oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor. Is an ortholog of C. elegans ctbp-1. In C. elegans, ctbp-1 is involved in negative regulation of transcription by RNA polymerase II. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG14767a.1 CBG14767a.1   [unknown]
Transcript:CBG14767b.1 CBG14767b.1   [unknown]
Transcript:CBG14767c.1 CBG14767c.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG14767a CBG14767a   [unknown]
CDS:CBG14767b CBG14767b   [unknown]
CDS:CBG14767c CBG14767c   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_upregulated
  Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day6_vs_Day1_downregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-ctbp-1, TATTTCAGATTCGGAAAGCCATCAATGGCCGGTGTCCACAAGACCTAACACATTGTATTA, WBGene00035167   Expr1057350 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  enables

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region