Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG14543b.1 | CBG14543b.1 | [unknown] | |
| Transcript:CBG14543a.1 | CBG14543a.1 | [unknown] |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:CBG14543b | CBG14543b | [unknown] | |
| CDS:CBG14543a | CBG14543a | [unknown] |
11 Allele
| Public Name |
|---|
| WBVar00121490 |
| WBVar00121491 |
| WBVar00121492 |
| WBVar00121493 |
| WBVar00121494 |
| WBVar00121495 |
| WBVar00121488 |
| WBVar00121489 |
| WBVar00121496 |
| WBVar00121497 |
| WBVar00121498 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG14543, AAGCGATTCGGGACATGTTCAAAGCCACCGACTTGAATGGGGATGGAAAAATCACATTCT, WBGene00035003 | Expr1061157 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
