WormBase Gene ID
|
WBGene00034843 | Gene Name | Cbr-fkh-9 |
| Sequence Name
|
CBG14292 | Organism | Caenorhabditis briggsae |
| Automated Description | Predicted to enable DNA-binding transcription factor activity and sequence-specific DNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans fkh-9. In C. elegans, fkh-9 is involved in several processes, including axon regeneration; determination of adult lifespan; and learning or memory. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG14292.1 | CBG14292.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-fkh-9, TGAGAATCCACAGAATCCATTGTTGCCAGGACTCAACGTTTTGGAACTTTTGAGCAATAT, WBGene00034843 | Expr1055306 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
