Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG14135a.1 | CBG14135a.1 | [unknown] | |
| Transcript:CBG14135b.1 | CBG14135b.1 | [unknown] |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:CBG14135a | CBG14135a | [unknown] | |
| CDS:CBG14135b | CBG14135b | [unknown] |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Heat shock: 34C 30min. | Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min. | DESeq2 v 1.18.1, fold change > 2, FDR < 0.01. | WBPaper00058955:heatshock_upregulated_CBG |
| Transcripts that showed significantly increased expression in day 6 adults of C.briggsae AF16 comparing to in day 3 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day3_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG14135, AATCGGAGAGGACGAAGTCATGAAGCAGAACGTATTCGTAGTCGAGAACCACAATCGTAG, WBGene00034733 | Expr1065527 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
