Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG13738.1 | CBG13738.1 | [unknown] |
Other
9 Allele
| Public Name |
|---|
| WBVar00137900 |
| WBVar00137902 |
| WBVar00137901 |
| WBVar00137903 |
| WBVar00137898 |
| WBVar00137897 |
| WBVar00137899 |
| WBVar00137896 |
| WBVar00137895 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_downregulated | |
| Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG13738, TGCTCTAATTGTGATTGGATACGGACCAGATTATTGGATTTTGAAGAACACCTACAGTAA, WBGene00034452 | Expr1050513 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
