WormBase Gene ID
|
WBGene00034290 | Gene Name | Cbr-kgb-1 |
| Sequence Name
|
CBG13536 | Organism | Caenorhabditis briggsae |
| Automated Description | Predicted to enable ATP binding activity and MAP kinase activity. Predicted to be involved in protein phosphorylation. Is an ortholog of C. elegans kgb-1. In C. elegans, kgb-1 is involved in several processes, including gamete generation; response to stress; and response to toxic substance. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG13536.1 | CBG13536.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-kgb-1, CGAAGAAGTGAATGCTCCAGCTTCTGAGAATCGTTACGATCAGGAAATTGATTTTGCTGA, WBGene00034290 | Expr1052007 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
